Homeschooling is hard.
Being a mom of 3 little ones is hard, but also homeschooling just really puts the pressure on for me.
I feel like I get nothing done and most days we don't finish everything I wanted to get through with either The Frog or Peach.
Today, I decided to write down all the interruptions to remind me why I don't get everything done.
It really made me feel better.
wanna see?
- Hazel brings me a toy with peanut butter on it for me to clean off so she can play with it
- Hazel brings me a bag with an old, post-frozen strawberry in it, which I soon discover has been smeared on the play kitchen and Hazel's hand/arm
- time-outs and kindness lesson (which is actually 2 interruptions because they must be sent into time-out and then retrieved)
- Hazel has a broken ornament and is eating its pieces. (what the... why?!!)
- Hazel climbed on the play kitchen and couldn't get down
-removing the Legos from the shower so I can take a shower without stepping on Legos
- time - outs and kindness lesson
- Cleaning up the "snack" the kids made for themselves while I was in the shower which involves wiping the table, chairs, bench and sweeping the floor. again.
- Lunch
- Hazel thoroughly spreading the hay meant for baby Jesus's manger and also sampling it. (am I not feeding her enough or what?)
- kid-bum wiping (this one is an every day one. multiple times.)
- time-outs and kindness lesson
- Prepping the lasagna for the missionaries
- Furnace guy comes over to do a regular check-up on the furnace
- Landlord comes by to watch the furnace guy
- We decide to move our furniture around so that The Frog and Peach no longer have to share a room, in hopes of them getting a decent amount of sleep and being less cranky. ALL. THE. TIME.
and those are just the ones I remember...
Showing posts with label homeschool. Show all posts
Showing posts with label homeschool. Show all posts
Wednesday, December 10, 2014
Thursday, May 1, 2014
Neighbor Swap Preschool
Disclaimer: this is more of a post for me and anyone who is thinking about teaching preschool to their kids. I have a really bad memory and so I'd like to remember what went well and what didn't with my "neighbor-swap" preschool for Peach.
Something else that has been taking up additional time is my preschool swap for Peach. There are 4 moms that take turns hosting, twice a week for 2 hours, and we have a schedule laid out for a letter of the week, just going through the alphabet. We are cheap and didn't want to pay for a curriculum. And also, all the kids but 1 were just barely 3, so they'll have another year for preschool. We just wanted it to be low-key, a semi-introduction for them to sitting still and playing nicely in a group. I thought about enrolling Peach somewhere, but I just wasn't ready for that. She seems so young! And we are doing homeschooling with her already, so I wasn't really concerned about her learning the academics- we are doing that at home.
Anyway, I finally finished my last week of teaching preschool, the week before Easter #thatwasabusyweek and I must say, I'm glad it's over. It was fun, but I'm just not really the preschool teacher type. I prefer teaching calculus. :)
However, if anyone else is interested in trying it out, I'm happy to share what I've learned. It is important for kids to have familiarity, especially if you want any learning to be going on, and since each week was going to be taught by a different mom, we thought it would be wise to have some kind of schedule, so the kids knew what to expect, as far as what types of things would be happening. This is ours, and I thought it worked out perfectly:
I made a little sign that we could hang up to remind the kids (but mostly the moms) about what was going to happen. We kept it in the box of preschool supplies that we passed around to whomever was teaching that week. Mostly it just had a ziplock baggie with a change of clothes for each child (in case of accidents) and also a little flag for the pledge of allegiance and some laminated cards I made that have the alphabet and numbers up to 10 on one side, and shapes and colors on the back. I made one for each child and the mom so we could point to the letters while we sing the ABCs every day. I later added to the sign, really small in pen, what time it should be when the task was over. That was really what I looked at more often. I also have a little visual timer and I would set that so the kids could see how much time was left before the next activity.
So here's a description of the schedule:
30 minutes of free play - kids can just play, and also made it low stress for us to get our kids there on time and so the mom hosting could have a little time to get last minute things together also.
5 minutes to clean up toys
20 minutes of "circle time" - we would say the pledge of allegiance, sing the ABCs with our chart, bring the letter, number, color and shape of the week, and read a story or two about one of said topics and maybe sing a song or two.
5 minutes to use the potty and wash hands before snack (really only needed a couple of minutes for that, but it's nice to have a bit of a buffer to finish up the story you're reading)
15 minutes of snack - we had a diabetic girl and a gluten free girl in our circle, so we had only no carb foods for snack. Things like lunch meat, pepperoni, cheese, hard boiled eggs. It would have been fun to do more fun things with the snack to go along with the letter of the week, but it actually made it less stressful to prepare a snack when your options were so limited.
15 minutes of outdoor recess - we almost always went outside during this time. Occasionally if the weather was really yucky, we'd stay in and dance to music or something active like that. One time I took them out to help me rake leaves. I felt a bit guilty for getting chores done with them around, but they had a lot of fun doing it!
25 minutes of an activity - These were usually more crafty things to help with fine motor skills (cutting, tracing, gluing), but one time, for example, we did Yoga for Y week.
5 minutes of clean up, and get shoes on to get ready for mom to pick up.
Some things I found particularly successful:
The kids love the "Shake your sillies out" song. (I only did the shake your sillies, jump your jiggles, clap your crazies, and itch your itchies verses). When circle time was getting noticeably restless, we'd do that and it gave them an outlet and they were ready to listen again.
Glue sticks with pre-cut shapes are a very simple activity for young kids. Have them put the shapes on the glue, and not the other way around.
They love the "hide the object" game, where you have them take turns hiding an object in a room while everyone else is outside the room and counts together. Whoever finds the object gets to hide it next. You have to make sure that everyone gets a turn to hide, though, or it can turn ugly.
They love pulling things out of a bag. I would often have a bag full of objects that start with the letter of the week and then we'd think of other things that start with that sound.
They love finding hidden things. I would often hide printed out letters in the room (of different fonts, so they could get used to seeing there is more than one way to write a letter) for them to bring back to my white board, and then we would take turns writing one on the board.
They like making noise- musical instruments or bells, even tapping spoons would probably be enough. Turn on some music, everyone's happy. However, that kind of activity is better as an intermediate. It won't hold them more than 5 minutes.
Bubbles. There's a reason they're still sold everywhere. A giant bubble maker would be awesome :)
Balloons. What kid doesn't love balloons?
They love dressing up. One time I gave them each something to wear made out of yarn while we read a story. (for Y week)
I printed out some simple worksheets online and laminated them and gave the kids dry erase markers to work on them. Some were matching capitol letters to lower case, some had simple addition, some just had the alphabet and they could try tracing it. I was surprised by how much everyone liked this, I mostly did it for the 5-year old so she would have something to do when she finished her tasks before the younger kids. (everyone else was barely 3 at the beginning of the school year)
They like feeling skilled and like they're doing something tricky. (I guess everyone mostly does, but they particularly like to prove how "big" they are.) Can you stand on one foot? Can you do a somersault? Can you hop over this?
Not so successful.
I found myself over estimating their abilities. a lot. Only one of the 5 kids (and she was 5) could really use scissors. We tried to do a little bit of sewing for J week (we had a coloring page with a Jellyfish and I thought it would be fun to sew some tentacles- if that's the right word- out of yarn through some holes in the paper I had poked with a large needle) and that was SO way beyond them- even the 5 year old was flummoxed. We did something similar at the end - Y week, where I gave them the letter Y I had hole-punched and cut out of card stock and they could just sew wherever with their yarn- they did a bit better with that. Maybe it was because there was no needle to fiddle with? Maybe because the holes were bigger? Maybe it's because it didn't really need to look like anything?
I found myself over-estimating how long they would spend on a task. a lot. Never did they spend more time than I thought. I still have no idea how to predict what activities will be fun and keep their attention. It's best to plan more than you think you'll need, just in case. That's where the laminated paper activities came in. They were backup that needed no prep.
I was really bad at getting kids not to interrupt the story with some tangential story from their life. I would just listen and acknowledge and try to get back to the story, but usually one life story would remind another kid about their take on it, etc. It didn't really stress me out... I mean, this is preschool people, we're not exactly prepping for the SATs, but it made me wonder if there was a way to get them not to do that, but still feel like their point of view was valuable. thoughts?
"guck guck moose!"
Something else that has been taking up additional time is my preschool swap for Peach. There are 4 moms that take turns hosting, twice a week for 2 hours, and we have a schedule laid out for a letter of the week, just going through the alphabet. We are cheap and didn't want to pay for a curriculum. And also, all the kids but 1 were just barely 3, so they'll have another year for preschool. We just wanted it to be low-key, a semi-introduction for them to sitting still and playing nicely in a group. I thought about enrolling Peach somewhere, but I just wasn't ready for that. She seems so young! And we are doing homeschooling with her already, so I wasn't really concerned about her learning the academics- we are doing that at home.
Anyway, I finally finished my last week of teaching preschool, the week before Easter #thatwasabusyweek and I must say, I'm glad it's over. It was fun, but I'm just not really the preschool teacher type. I prefer teaching calculus. :)
However, if anyone else is interested in trying it out, I'm happy to share what I've learned. It is important for kids to have familiarity, especially if you want any learning to be going on, and since each week was going to be taught by a different mom, we thought it would be wise to have some kind of schedule, so the kids knew what to expect, as far as what types of things would be happening. This is ours, and I thought it worked out perfectly:
I made a little sign that we could hang up to remind the kids (but mostly the moms) about what was going to happen. We kept it in the box of preschool supplies that we passed around to whomever was teaching that week. Mostly it just had a ziplock baggie with a change of clothes for each child (in case of accidents) and also a little flag for the pledge of allegiance and some laminated cards I made that have the alphabet and numbers up to 10 on one side, and shapes and colors on the back. I made one for each child and the mom so we could point to the letters while we sing the ABCs every day. I later added to the sign, really small in pen, what time it should be when the task was over. That was really what I looked at more often. I also have a little visual timer and I would set that so the kids could see how much time was left before the next activity.
So here's a description of the schedule:
30 minutes of free play - kids can just play, and also made it low stress for us to get our kids there on time and so the mom hosting could have a little time to get last minute things together also.
5 minutes to clean up toys
20 minutes of "circle time" - we would say the pledge of allegiance, sing the ABCs with our chart, bring the letter, number, color and shape of the week, and read a story or two about one of said topics and maybe sing a song or two.
5 minutes to use the potty and wash hands before snack (really only needed a couple of minutes for that, but it's nice to have a bit of a buffer to finish up the story you're reading)
15 minutes of snack - we had a diabetic girl and a gluten free girl in our circle, so we had only no carb foods for snack. Things like lunch meat, pepperoni, cheese, hard boiled eggs. It would have been fun to do more fun things with the snack to go along with the letter of the week, but it actually made it less stressful to prepare a snack when your options were so limited.
15 minutes of outdoor recess - we almost always went outside during this time. Occasionally if the weather was really yucky, we'd stay in and dance to music or something active like that. One time I took them out to help me rake leaves. I felt a bit guilty for getting chores done with them around, but they had a lot of fun doing it!
25 minutes of an activity - These were usually more crafty things to help with fine motor skills (cutting, tracing, gluing), but one time, for example, we did Yoga for Y week.
5 minutes of clean up, and get shoes on to get ready for mom to pick up.
Some things I found particularly successful:
The kids love the "Shake your sillies out" song. (I only did the shake your sillies, jump your jiggles, clap your crazies, and itch your itchies verses). When circle time was getting noticeably restless, we'd do that and it gave them an outlet and they were ready to listen again.
Glue sticks with pre-cut shapes are a very simple activity for young kids. Have them put the shapes on the glue, and not the other way around.
They love the "hide the object" game, where you have them take turns hiding an object in a room while everyone else is outside the room and counts together. Whoever finds the object gets to hide it next. You have to make sure that everyone gets a turn to hide, though, or it can turn ugly.
They love pulling things out of a bag. I would often have a bag full of objects that start with the letter of the week and then we'd think of other things that start with that sound.
They love finding hidden things. I would often hide printed out letters in the room (of different fonts, so they could get used to seeing there is more than one way to write a letter) for them to bring back to my white board, and then we would take turns writing one on the board.
They like making noise- musical instruments or bells, even tapping spoons would probably be enough. Turn on some music, everyone's happy. However, that kind of activity is better as an intermediate. It won't hold them more than 5 minutes.
Bubbles. There's a reason they're still sold everywhere. A giant bubble maker would be awesome :)
Balloons. What kid doesn't love balloons?
They love dressing up. One time I gave them each something to wear made out of yarn while we read a story. (for Y week)
I printed out some simple worksheets online and laminated them and gave the kids dry erase markers to work on them. Some were matching capitol letters to lower case, some had simple addition, some just had the alphabet and they could try tracing it. I was surprised by how much everyone liked this, I mostly did it for the 5-year old so she would have something to do when she finished her tasks before the younger kids. (everyone else was barely 3 at the beginning of the school year)
They like feeling skilled and like they're doing something tricky. (I guess everyone mostly does, but they particularly like to prove how "big" they are.) Can you stand on one foot? Can you do a somersault? Can you hop over this?
Not so successful.
I found myself over estimating their abilities. a lot. Only one of the 5 kids (and she was 5) could really use scissors. We tried to do a little bit of sewing for J week (we had a coloring page with a Jellyfish and I thought it would be fun to sew some tentacles- if that's the right word- out of yarn through some holes in the paper I had poked with a large needle) and that was SO way beyond them- even the 5 year old was flummoxed. We did something similar at the end - Y week, where I gave them the letter Y I had hole-punched and cut out of card stock and they could just sew wherever with their yarn- they did a bit better with that. Maybe it was because there was no needle to fiddle with? Maybe because the holes were bigger? Maybe it's because it didn't really need to look like anything?
I found myself over-estimating how long they would spend on a task. a lot. Never did they spend more time than I thought. I still have no idea how to predict what activities will be fun and keep their attention. It's best to plan more than you think you'll need, just in case. That's where the laminated paper activities came in. They were backup that needed no prep.
I was really bad at getting kids not to interrupt the story with some tangential story from their life. I would just listen and acknowledge and try to get back to the story, but usually one life story would remind another kid about their take on it, etc. It didn't really stress me out... I mean, this is preschool people, we're not exactly prepping for the SATs, but it made me wonder if there was a way to get them not to do that, but still feel like their point of view was valuable. thoughts?
"guck guck moose!"
Wednesday, October 23, 2013
Beginning Reading Games for the Car
I don't know about you, BUT driving around in the car can be SUCH a chore (especially when you have 3 carseats in the back of a Honda Civic, i.e. they can all whack touch each other...) Lately, since we've been "trail-run-homeschooling", and I've been thinking a lot about how to teach kids to read, I've been trying out some car "games" to help our reading practice. Probably most people already do stuff like this, but maaaybe there's a first-time mom out there that might find these useful.
Traditional Alphabet Game
I'm sure there isn't a person out there that doesn't know what this is... but JUST in case, all you do is try to find all the letters of the alphabet starting with letter A and making your way to Z. Jay always plays it so that the letter can be anywhere in a word, but if you like more of a challenge, it can be fun to only allow it to be the first letter of a word. I find this is a great way for kids to practice thinking about the letter order w/out singing the song every time, and it also just helps with seeing signs as something other than an unrecognizable foreign language.
Alphabet Game for Beginners
This is better for kids who are just learning their letters. You can instead try to have them only point out every A they can see. (You could even specify "Big A" or "little a"). Then you can move on to other letters as you see fit. You could even, instead, help them get used to finding letters in their own name first.
Say It Fast
This is a game that helps for when kids start sounding out words themselves. Something I've noticed with The Frog is he will sound out the whole word "caaaaaaaaataaaaaaaaapuuuuuuuuulllllllllllt" and get to the end, having no idea what he just said. SO, this game is intended to help them get used to hearing a word said really slowly, and then registering what word it is. For example, I would say,
"Mmmmmmaaaaaaaaaannnnnnnn. Say it fast!" and the kids would yell, "MAN!"
"sssssssssssssseeeeeeeeeeeeeeeeeet. Say It Fast!"
"SEAT!"
etc. Obviously, you would start with short words (and maybe even try to think of words that might be encountered with the earliest reading) and once they get good, you can do long ones. (Pneumonoultramicroscopicsilicovolcanoconiosis?)
You could also do themed words, like if you've been talking about ancient Egypt, do words like, "pyramid", "mummification", "Nile", etc.
The Rhyming Game
This is also great for kids because if they can recognize rhyming words, then when they have already read something like "hike", it will be easier to recognize "bike" later. So, basically, you pick any word and get them to say things that rhyme with it. I usually throw some out as well. It's amazing how much car-time you can pass with this.
Sound it Out
This one, I admittedly haven't tried yet, but I just thought of it and I'd like to see how it goes. Probably The Frog is the only one knowledgable enough for this one, but probably Peach would get the hang of it after listening to him do it.
It's a bit like the opposite of "Say It Fast". The idea is to just pick a word, and then say it slowly together and try to figure out which letters are making all the sounds.
I do an exercise like this with The Frog everyday as part of out "trial-run-homeschooling"- we pick any old sentence (yesterday's was, "I have pen on my face.", because The Frog, unknowingly, did have pen on his face, and I thought it was funny :D) and try to sound out all the words. The Frog will do his best to write them down on his own and then I'll go over it with him and write it all down correctly after. Then we each circle our favorite letters (the ones that are written the best.) to help him pay more attention to his handwriting. So, anyway, I thought maybe we could try doing it all mentally in the car too! We'll see :)
What are your favorite ways to pass the time in the car?
PS you don't have to be in the car to play these games. in case that was unclear... :)
Traditional Alphabet Game
I'm sure there isn't a person out there that doesn't know what this is... but JUST in case, all you do is try to find all the letters of the alphabet starting with letter A and making your way to Z. Jay always plays it so that the letter can be anywhere in a word, but if you like more of a challenge, it can be fun to only allow it to be the first letter of a word. I find this is a great way for kids to practice thinking about the letter order w/out singing the song every time, and it also just helps with seeing signs as something other than an unrecognizable foreign language.
Alphabet Game for Beginners
This is better for kids who are just learning their letters. You can instead try to have them only point out every A they can see. (You could even specify "Big A" or "little a"). Then you can move on to other letters as you see fit. You could even, instead, help them get used to finding letters in their own name first.
Say It Fast
This is a game that helps for when kids start sounding out words themselves. Something I've noticed with The Frog is he will sound out the whole word "caaaaaaaaataaaaaaaaapuuuuuuuuulllllllllllt" and get to the end, having no idea what he just said. SO, this game is intended to help them get used to hearing a word said really slowly, and then registering what word it is. For example, I would say,
"Mmmmmmaaaaaaaaaannnnnnnn. Say it fast!" and the kids would yell, "MAN!"
"sssssssssssssseeeeeeeeeeeeeeeeeet. Say It Fast!"
"SEAT!"
etc. Obviously, you would start with short words (and maybe even try to think of words that might be encountered with the earliest reading) and once they get good, you can do long ones. (Pneumonoultramicroscopicsilicovolcanoconiosis?)
You could also do themed words, like if you've been talking about ancient Egypt, do words like, "pyramid", "mummification", "Nile", etc.
The Rhyming Game
This is also great for kids because if they can recognize rhyming words, then when they have already read something like "hike", it will be easier to recognize "bike" later. So, basically, you pick any word and get them to say things that rhyme with it. I usually throw some out as well. It's amazing how much car-time you can pass with this.
Sound it Out
This one, I admittedly haven't tried yet, but I just thought of it and I'd like to see how it goes. Probably The Frog is the only one knowledgable enough for this one, but probably Peach would get the hang of it after listening to him do it.
It's a bit like the opposite of "Say It Fast". The idea is to just pick a word, and then say it slowly together and try to figure out which letters are making all the sounds.
I do an exercise like this with The Frog everyday as part of out "trial-run-homeschooling"- we pick any old sentence (yesterday's was, "I have pen on my face.", because The Frog, unknowingly, did have pen on his face, and I thought it was funny :D) and try to sound out all the words. The Frog will do his best to write them down on his own and then I'll go over it with him and write it all down correctly after. Then we each circle our favorite letters (the ones that are written the best.) to help him pay more attention to his handwriting. So, anyway, I thought maybe we could try doing it all mentally in the car too! We'll see :)
What are your favorite ways to pass the time in the car?
PS you don't have to be in the car to play these games. in case that was unclear... :)
Tuesday, October 8, 2013
Peach's Preschool - B week
Wow! I guess Jay being out of town for 2 WEEKS really played a toll on how much I was able to get done. I just haven't been able to make time for fun things like blogging. I haven't been taking pictures of anything either!!
I have started doing a preschool co-op with 3 other moms in the neighborhood and this week is my first week taking my turn. As you may have guessed, I would over-plan and needlessly stress out over having a good lesson plan. I'm going to keep track of what I did, mostly for my own records.
We're talking about the letter B, the color purple, triangles, and the number 1 this week. Yesterday we talked about Bugs and Birds:
-I had a bag full of B objects and they took turns pulling them out one-by-one. (probably I had too many in there... Everyone got to pull out 3 or 4)
-We read The Very Lonely Firefly board book
by Eric Carl and Owl Babies
by Martin Waddell (and I also had a stack of 5 others, just in case...).
-We sung "itsy bitsy spider" and the "baby bumble bee" song (I don't even know it's official name...)
-We looked for bugs outside together
-We "danced" (i.e. ran around like mad) to the Flight of the Bumblebee song, and they liked that so much, I picked something else by Beethoven to pretend to be Butterflies or Ballerinas to.
-Our snacks are quite limited because one of the girls is diabetic, so it must have <1g and="" carbs.="" e="" egg="" eggs="" fun="" had="" hard-boiled="" kids="" my="" nbsp="" p="" peeling="" slicer.="" the="" them="" using="">-We made little "hand butterflies" and decorated them with triangles I tried to get the kids to cut out. (not a great idea...) Next time I'll have strips already cut out and show them how to make triangles with small snips. I had originally planned to make these little toilet paper tube owls, but when I woke up early to cut out the fabric scrap pieces, I discovered that someone had used my fabric shears for something other than fabric and had totally ruined them. (there were all these little nicks along the blade), so I did the butterflies as last-minute backup. I also had prepared these cute firefly jars, but I knew they would be SO fast, that I didn't start off with them. However, we ran out of time.
-I also printed off a worksheet for them to trace through an easy path and color some B things on the back while they waited for moms to come get them.
We're talking about bodies tomorrow, and more about 1s.
Anyone have a good method to make gluing things for 3-year-olds easier/less messy?
I have started doing a preschool co-op with 3 other moms in the neighborhood and this week is my first week taking my turn. As you may have guessed, I would over-plan and needlessly stress out over having a good lesson plan. I'm going to keep track of what I did, mostly for my own records.
We're talking about the letter B, the color purple, triangles, and the number 1 this week. Yesterday we talked about Bugs and Birds:
-I had a bag full of B objects and they took turns pulling them out one-by-one. (probably I had too many in there... Everyone got to pull out 3 or 4)
-We read The Very Lonely Firefly board book
by Eric Carl and Owl Babies by Martin Waddell (and I also had a stack of 5 others, just in case...). -We sung "itsy bitsy spider" and the "baby bumble bee" song (I don't even know it's official name...)
-We looked for bugs outside together
-We "danced" (i.e. ran around like mad) to the Flight of the Bumblebee song, and they liked that so much, I picked something else by Beethoven to pretend to be Butterflies or Ballerinas to.
-Our snacks are quite limited because one of the girls is diabetic, so it must have <1g and="" carbs.="" e="" egg="" eggs="" fun="" had="" hard-boiled="" kids="" my="" nbsp="" p="" peeling="" slicer.="" the="" them="" using="">-We made little "hand butterflies" and decorated them with triangles I tried to get the kids to cut out. (not a great idea...) Next time I'll have strips already cut out and show them how to make triangles with small snips. I had originally planned to make these little toilet paper tube owls, but when I woke up early to cut out the fabric scrap pieces, I discovered that someone had used my fabric shears for something other than fabric and had totally ruined them. (there were all these little nicks along the blade), so I did the butterflies as last-minute backup. I also had prepared these cute firefly jars, but I knew they would be SO fast, that I didn't start off with them. However, we ran out of time.
-I also printed off a worksheet for them to trace through an easy path and color some B things on the back while they waited for moms to come get them.
We're talking about bodies tomorrow, and more about 1s.
Anyone have a good method to make gluing things for 3-year-olds easier/less messy?
Thursday, September 26, 2013
Homeschooling- earliest math and money
So, Jay really, really, really wants to homeschool our kids, because he wishes he could have been homeschooled. I admit, I can see how much better one-on-one attention would be, how much time must wasted by busy-work when one teacher must teach 30 kids at different levels, how public schools must be run for efficiency, not necessarily for maximal learning, etc. etc. BUT, I still have some reservations about some of the social things, worries about parent/child clash, and wonderings if I could even pull it off better than people who have been doing it for 30 years. 'Cause anyone who knows me knows that I **heart** school. Seriously! If I had my way, I would just live on a college campus and take classes the rest of my life. I just love to learn! BUT, looking back, I could have probably learned a lot more had I been given one-on-one (or even one-on-3) attention. However, I am to this day, a pretty awkward person, and without school, I would not know my 2 dearest friends from HS (Hi Linds! Hi Mel!) who know me in a way nobody else ever could, because they were with me through thick and thin since, yes, 7TH GRADE. And to me, that is invaluable.
BUT, perhaps if I were homeschooled, I would have had more time for social endeavors, and would have tried to make them count more. Once I hit 7th grade, I did have to pare down on my extracurriculars due to time constraints. I was sad to let the Salt Lake Children's Choir go. It would have been fun to keep up on basketball. I was sad to stop soccer after the next year. And I could have sought out other unique activities that I just plain didn't have time for with everything else...
So, ANYWAY, I'm willing to give it a shot. For now, we are happy to have our kids attend BYU preschool and kindergarten- two affordable and excellent programs that do give the kids individual attention with a student:teacher ratio of 4:1. Meanwhile, Jay and I want to set-up shop and start a routine so we can lay a foundation for later when it really matters more.
I've been really interested in alternative methods for learning math and I've been intrigued by these Cuisenaire Rods
. You can read more about them here. I really stumbled upon them on amazon.com when I was looking for some game pieces to use to make a sort of Sequence game for learning letters. And then I saw these Interlocking Centimeter Cubes
and I thought they could probably work for both!
So, I got them and I had no idea how excited the kids (especially The Frog) would be about playing with them.
We've made faces and flowers and even little scenes with them. But they've also worked great as homemade cuisenaire rods. (They aren't in the "official" color order here, because I thought rainbow order would be easier to remember. BUT, I could easily change that :D)
I thought it would be a good idea to get some kind of book to guide me with them at first, and decided upon this one: Miquon Math, Level 1
. Some of the reviews said they thought Lab Sheet Annotations and Mathematics for the Primary Teacher
and First-Grade Diary were essential companions, but I'm planning to just check out the first book before I commit. (Also, since math is kinda my "thing" maybe I won't need answers, explanations, etc?)
I got it, and yes, it has no instruction whatsoever, but I think I get the gyst.
I actually haven't used them much with The Frog yet because I want to finish up what we've started already (just some addition flash cards we have, using fingers or drawn dots to figure them out) and also because he's been doing subtraction that results in negative numbers already too, and I haven't figured out a great way of doing that with the rods yet. BUT, I whipped it out with Peach and she had fun doing the first couple of pages (which was just counting) and was especially excited to use "the pink ones". (an added benefit of using these blocks instead of the rods)
I think I had my first big win, though, when I used them to talk about money with The Frog. I've tried to explain coin values to him before, but I just don't have enough pennies lying around to get the point across, and it's also tedious and hard to move them around fast enough when they're all separate. I think doing this really helped him understand and he keeps asking if we can learn about money again. Yay!! I'll report again later when I've experimented a bit more.
I've thought about starting a separate homeschooling blog where I can keep track of what we did, what went well, what didn't, so I'll have a good place to reference for the "next round".
Any clever title ideas?
BUT, perhaps if I were homeschooled, I would have had more time for social endeavors, and would have tried to make them count more. Once I hit 7th grade, I did have to pare down on my extracurriculars due to time constraints. I was sad to let the Salt Lake Children's Choir go. It would have been fun to keep up on basketball. I was sad to stop soccer after the next year. And I could have sought out other unique activities that I just plain didn't have time for with everything else...
So, ANYWAY, I'm willing to give it a shot. For now, we are happy to have our kids attend BYU preschool and kindergarten- two affordable and excellent programs that do give the kids individual attention with a student:teacher ratio of 4:1. Meanwhile, Jay and I want to set-up shop and start a routine so we can lay a foundation for later when it really matters more.
I've been really interested in alternative methods for learning math and I've been intrigued by these Cuisenaire Rods
. You can read more about them here. I really stumbled upon them on amazon.com when I was looking for some game pieces to use to make a sort of Sequence game for learning letters. And then I saw these Interlocking Centimeter Cubes and I thought they could probably work for both!So, I got them and I had no idea how excited the kids (especially The Frog) would be about playing with them.
I thought it would be a good idea to get some kind of book to guide me with them at first, and decided upon this one: Miquon Math, Level 1
. Some of the reviews said they thought Lab Sheet Annotations and Mathematics for the Primary Teacher and First-Grade Diary were essential companions, but I'm planning to just check out the first book before I commit. (Also, since math is kinda my "thing" maybe I won't need answers, explanations, etc?) I got it, and yes, it has no instruction whatsoever, but I think I get the gyst. |
| do you recognize this scene? |
 |
| using our rods to show coin values |
I've thought about starting a separate homeschooling blog where I can keep track of what we did, what went well, what didn't, so I'll have a good place to reference for the "next round".
Any clever title ideas?
Subscribe to:
Posts (Atom)